##
## do not remove the extra print statements
print('Question 1')
#################################################################
# QUESTION 1                                                    #
#   
# Write a for-loop with a corresponding range function to 
# compute the sum of the first 100 natural numbers. In other words, 
# using the for-loop compute the sum of 1 + 2 + 3 + ... + 100
#
# **your answer should use a for-loop. You will get 0 points if 
# you do not use a for-loop.
#
# Your output should be a single line stating "The sum of the
# first 100 natural numbers is: " followed by the result.
#                                                               #
#################################################################

## add code for question 1 here



## do not remove the extra print statements
print('Question 2')
#################################################################
# QUESTION 2                                                    #
#                                                               
# Using a while-loop, create a list that has the same contents 
# as this range function output:
# 
# >>> list(range(3,26,4))
# [3, 7, 11, 15, 19, 23]
# 
# **your answer should use a while-loop. You will get 0 points if 
# you do not use a while-loop.
#
# Your output should be a single line with the correct list.
#                                                               #
#################################################################

## add code for question 2 here



## do not remove the extra print statements
print('Question 3')
#################################################################
# QUESTION 3                                                    #
#                                                               
# For the following string variable RNA, loop through all the 
# matches to AUG, print out each sequence that starts with AUG 
# (including the AUG itself) along with the remaining sequence 
# to the end. 
# 
# RNA = 'GCACGACGAUGGAUGCAUGUCUGACUAGCUGAUCGACGAUGCACGUCAGCACUGACUGAUGACGACU'
# 
# Your output should consist of one sequence per line, each
# starting with 'AUG'.
#                                                               #
#################################################################

RNA = 'GCACGACGAUGGAUGCAUGUCUGACUAGCUGAUCGACGAUGCACGUCAGCACUGACUGAUGACGACU'
## add code for question 3 here



## do not remove the extra print statements
print('Question 4')
#################################################################
# QUESTION 4                                                    #
#                                                               
# For the following DNA sequence, create a new string that is the 
# string concatenation of two substrings. The first substring 
# should begin at (0-based) index 15 and be of length 5. The second 
# substring should be the reverse of the sequence starting at 
# (0-based) index 20 and going up to and including index 31. 
#
# DNA = 'TGTTCGTTCTGCCTGCGGTTGGTGCAACACTAACAGCAACAGCAGTGTCGAGAAAAAGCGGGAAATCCAACCTT'
#
# Your output should be a single line with just the requested 
# output string.
#                                                               #
#################################################################

DNA = 'TGTTCGTTCTGCCTGCGGTTGGTGCAACACTAACAGCAACAGCAGTGTCGAGAAAAAGCGGGAAATCCAACCTT'
## add code for question 4 here



## do not remove the extra print statements
print('Question 5')
#################################################################
# QUESTION 5                                                    #
#                                                               
# For the following tuple, convert it to a list, then modify the 
# element 'candy' and replace it with 'celery', and then convert 
# it back to a tuple with the same variable name. 
#
# shopping_cart = ('apples','bread','candy')
#
# Your output should be a single line with the tuple printed out.
# 
#                                                               #
#################################################################

shopping_cart = ('apples','bread','candy')
## add code for question 5 here


## do not remove the extra print statements
print('Question 6')
#################################################################
# QUESTION 6                                                    #
#                                                               
# Transcription without the replace() method
#
# DNA is similar to RNA, but 'T' is replaced with 'U'. 
#
# For the following DNA sequence, convert it to RNA using a for-loop. 
# Your for-loop must traverse each character of the DNA sequence 
# and concatenate to the RNA sequence: if the DNA character is a 
# 'T' you should concatenate a 'U' to the RNA sequence, otherwise 
# concatenate the original DNA character.
#
# **your answer should use a for-loop and not use the replace() 
# method (you will get 0 points if you use replace function). 
#
# Hint: You need to use an if and else loop to confirm each 
# character in the for loop.
#
# DNA = 'TGTTCGTTCTGCCTGCGGTTGGTGCAACACTAACAGCAACAGCAGTGTCGAGAAAAAGCGGGAAATCCAACATCGCGTCGCCTAAG'
# 
# Your output should be the RNA string on a single line.
#
#                                                               #
#################################################################

DNA = 'TGTTCGTTCTGCCTGCGGTTGGTGCAACACTAACAGCAACAGCAGTGTCGAGAAAAAGCGGGAAATCCAACATCGCGTCGCCTAAG'
RNA = ''
## add code for question 6 here



## do not remove the extra print statements
print('Question 7')
#################################################################
# QUESTION 7                                                    #
#                                                               
# Using the range function and list concatenation, create the 
# following list (in the same order as shown):
#
# [5, 8, 11, 14, 17, 20, 22, 24, 26, 28]
#
# Your output should consist of the correct list on a single line.
# 
#                                                               #
#################################################################

## add code for question 7 here