## Programming Assignment #2

## do not remove the extra print statements
print('Question 1')
#################################################################
# QUESTION 1                                                    #
# Using substrings, write a statement that would print out the  #
# string DNA, but it would leave out the position indexed by 5  #
# where 5 is the index in python 0-based indexing).             #
#################################################################



##add code for question 1 here
DNA = "TGCTAGCATCGATGCTGACTGATCGAC"


## do not remove the extra print statements
print('Question 2')
#################################################################
# QUESTION 2                                                    #
# Define a variable "i" that has the value of 3. Then define a  #
# variable "j" that has a value of 11. Then define a random     #
# string called "DNA" that is 15 characters long (something     #
# other than all one or two characters, something complex).     #
#                                                               #
# Then print the substring of DNA starting i and of length j.   #
# your substring should be in terms of the variables i and j.   #
#################################################################



##add code for question 2 here


## do not remove the extra print statements
print('Question 3')
#################################################################
# QUESTION 3                                                    #
# Define a subsequence and print statement that would print every    #
# third character starting at the first 'G' for the provided    #
# DNA sequence:                                                 #
# DNA = 'TTCAGTGACTGATCGATCGATGCTAGCTAGCTAGC'                   #
#################################################################


##add code for question 3 here
DNA = 'TTCAGTGACTGATCGATCGATGCTAGCTAGCTAGC'


## do not remove the extra print statements
print('Question 4')
#################################################################
# QUESTION 4                                                    #
# Define as subsequence and print statement that would print    #
# every other character of the following sequence in reverse    #
# starting at the last T:                                       # 
#                                                               #
# DNA = "GACTATGATCGTAGTGATCGTAGCTAGCTAGCATCGTAGGC"             #
#################################################################


##add code for question 4 here
DNA = "GACTATGATCGTAGTGATCGTAGCTAGCTAGCATCGTAGGC"


## do not remove the extra print statements
print('Question 5')
#################################################################
# QUESTION 5                                                    #
# Given the two strings, convert them both to int data types,   # 
# and add the associated numerical values, then convert the     # 
# resulting sum to a string, and print the resulting sum string 
# variable
#################################################################

##add code for question 4 here
x = '784'
y = '541'