Copy and paste the following hairpin sequence to a fasta file called "hairpin.fasta":
>hairpin
ACAUACUUCUUUAUAUCCAUAUGAACCUGCUAAGCUAUGGAUGUAAAGAAGUAUGU
Fold this hairpin with RNAfold:
cat hairpin.fasta | RNAfold
Comment on the hairpin structure and the energy (given in parentheses). How big is the hairpin loop in terms of number of nucleotides?
Now let's use RNAduplex to compute the energy of the RNA duplex formed by two RNA strands. Create a fasta file with the following arms of the hairpin:
>five
ACAUACUUCUUUAUAUCCAUA
>three
UAUGGAUGUAAAGAAGUAUGU
Now compute the duplex energy:
cat arms.fasta | RNAduplex
Given the differences in energies between the duplex and the hairpin, How much destabilizing energy would you say the hairpin loop give?
Make a table with the difference in the hairpin energies and the duplex energies for the different lengths. How does the difference in energy change with the length of the loop? How does this compare to the equation given in class?
| loop length (nt) | Duplex Energy (kcal/mol) | Hairpin Energy (kcal/mol) | Change |
|---|---|---|---|
| 4 | |||
| 6 | |||
| 8 | |||
| 10 | |||
| 12 | |||
| 14 | |||
| 16 | |||
| 18 | |||
| 20 | |||
| 22 |