Lab 8: RNA Structure

Structure Prediction with the ViennaRNA package

RNA Structure Prediction with RNAfold

Copy and paste the following hairpin sequence to a fasta file called "hairpin.fasta":

	  >hairpin
	  ACAUACUUCUUUAUAUCCAUAUGAACCUGCUAAGCUAUGGAUGUAAAGAAGUAUGU
      

Fold this hairpin with RNAfold:

	  cat hairpin.fasta | RNAfold
      

Comment on the hairpin structure and the energy (given in parentheses). How big is the hairpin loop in terms of number of nucleotides?

RNA Duplex Prediction with RNAduplex

Now let's use RNAduplex to compute the energy of the RNA duplex formed by two RNA strands. Create a fasta file with the following arms of the hairpin:

	  >five
	  ACAUACUUCUUUAUAUCCAUA
	  >three
	  UAUGGAUGUAAAGAAGUAUGU
      

Now compute the duplex energy:

	  cat arms.fasta | RNAduplex
      

Given the differences in energies between the duplex and the hairpin, How much destabilizing energy would you say the hairpin loop give?

The Destabilzing Energy of a Hairpin loop

Let's make the calculation of the hairpin loop's destabilizing energy more rigorous. Let's try increasing the length of the hairpin loop by inserting nucleotides to the hairpin sequence above in increments of two. Note: You should choose nucleotides that aren't self-complementary to avoid creating more base pairs.

Make a table with the difference in the hairpin energies and the duplex energies for the different lengths. How does the difference in energy change with the length of the loop? How does this compare to the equation given in class?